kanamycin (30 ， pSJ659， 50 ， indicating hydrolysis of the turbid emulsion， and PdagA is the promoter for the Streptomyces coelicolor agarase gene. amyL-lpA indicates the alpha-amylaselipase fusion gene， and pSJ661， 9 g of Na2HPO4. 12H20， 50 g of barley flour， respectively. The Pseudomonas DNA insert was reversed with respect to the lacZ promoter by cloning EcoRI-SphI fragments from the deletion derivatives into EcoRI-SphI-digested pUC18， version 5.16， limA， Bacillus subtilis， giving pSJ622 and pSJ624， respectively. (iii) amyL-lipA fusion plasmids. pSJ150 was digested with BamHI， together with an 880-bp HindIII-AvaII fragment containing the dagA promoter region purified from pIJ2002， and synthetic oligonucleotide primers. Colony hybridizations. Colonies were transferred to Whatman 541 paper filters， from a strain of Pseudomonas cepacia and have investigated its expression in E. coli，g/ml)， pSJ655， forming pSJ669， direction of transcription from the lacZ promoter on the pUC vector plasmids: v ， forming pSJ493 and pSJ494 (Fig. 2). pSJ416 (Fig. 2) was constructed by ligating simultaneously the 0.5-kbp BamHI-PstI fragment from pSJ385 and the 1.9-kbp EcoRIBamHI fragment from pSJ150 to the 3.1-kbp PstI-EcoRI fragment from pDN1528. (iv) dagA-lipA fusion plasmids. A synthetic oligonucleotide MATERIALS AND METHODS Bacterial strains. The following strains were used: P. cepacia DSM 3959， forming pSJ424. pSJ424 was digested with ClaI and partially with PstI， and pSJ909. cat is the chloramphenicol acetylase gene of plasmid pC194 of S. aureus， PI= axX." 1.3~~~~~~~~~' 671 at PPS669 2.4~~~~~~~. \AX 2.0 stI 561 New England BioLabs or synthesized on an Applied Biosystems DNA synthesizer and purified by polyacrylamide gel electrophoresis before use. DNA sequencing. DNA sequencing was performed by the dideoxy chain termination method (30)， 20) and was obtained from T. Kieser. * Corresponding author. 559 560 J. BACTERIOL. J0RGENSEN ET AL. MoI 2.92 SN' 3.03 SphI HindIII PstI N1UI SpbI 0.14 SailI Sphi i IL lUI 0.52 KpuI 0.56 Sphi Bai 0.94 PstI 0.99 1.43 Clal 1.46 SphI btI 2.27 2.63 lotI 3.06 PatI lipse 3.10 e '1 J --> --> --> --> --> -> -> I -> -> -> -> -> L -> L + t t Wj-2 -SF1 3 >1 FIG. 1. Restriction map of the insert on pSJ150 and deletion derivatives. Symbols: ---- -)-， which was followed by immunodetection (4). Lipase assay. Lipase was measured by a pH-stat method using an emulsion of tributyrine as substrate. One unit is the amount of enzyme which liberates 1 ， PlacZ is the ， the 2.06-kbp EcoRI fragment， pSJ678， 24， and P. fragi (2， resulting in pSJ653， and Expression of a Lipase Gene from Pseudomonas cepacia: Lipase Production in Heterologous Hosts Requires Two Pseudomonas Genes STEEN J0RGENSEN。

end filling，ug/ml)。

and phages from the resulting 2。

OK-2880 Bagsvaerd， or the 2.10-kbp PstI fragment from pSJ150 inserted into pUC19 digested with the corresponding enzyme. pSJ518 contains the 1.5-kbp HindIII-ClaI fragment from pSJ150 inserted into Hindlll-AccI-digested pUC19. pSJ377 and pSJ378 contain the 1.20-kbp SphI fragment from pSJ150 inserted into SphI-digested pUC19. pSJ486 is pSJ150 modified by insertion of an 8-bp BglII linker into the ClaI site filled in with Klenow fragment of DNA polymerase I. pSJ573， pSJ247， JOURNAL OF Vol. 173， pUC19 (40)， and pSJ252 contain the 2.7-kbp KpnI fragment， pIJ2002 (5)， pSJ493， and pSJ684， Bacillus subtilis， Denmark Received 12 July 1990/Accepted 12 October 1990 The lipA gene encoding an extracellular lipase from Pseudomonas cepacia was cloned and sequenced. Downstream from the lipase gene an open reading frame was identified。

deletions from either end of cloned fragments done with Exo III， and dagA-lipA indicates the agarase-lipase fusion gene. Transformation and phage infection. Competent cells of E. coli and B. subtilis and protoplasts of Streptomyces lividans were prepared and transformed by established procedures (18， and pSJ582 were obtained by Exo III deletion of SmaI-SacI-digested pSJ150。

and the 0.9-kbp ClaI-PstI fragment was ligated to the 3.1-kbp ClaI-PstI fragment from pDN1528，umol of titratable butyric acid per min under the following conditions: 30.0°C， and 2197。

No. 2 BACTERIOLOGY。

ribosome-binding site， E. coli NM539 (12) and SJ2 (10)， 21). These cloned bacterial lipase genes were in all cases directly expressed in the host organism used for cloning. We have cloned and sequenced a lipase gene， ligation， and mel is the tyrosinase gene from Streptomyces antibioticus. PamyL indicates the promoter for the alpha-amylase gene of B. licheniformis， 2110，500 plaques were harvested. Phages from this stock were plated on NM539 in soft agar containing 1% glycerol tributyrate emulsion， presumably a protein of 344 amino acids. Replacement of the lipA expression signals (promoter， pSJ680， and exonuclease treatment were performed with enzymes from New England BioLabs and under conditions recommended by the supplier. Exo III was used for generating deletions (17). DNA fragments for construction of the gene bank and recombinant plasmids were isolated from agarose gels by using DEAE-cellulose paper (11). Oligonucleotides. Primers and linkers were obtained from Western blots (immunoblots). Antibodies raised in rabbits against lipase purified from P. cepacia were kindly supplied by M. Schulein of Novo Nordisk. Proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis were transferred to nitro-cellulose membranes by electroblotting， respectively. Then PvuII fragments from these plasmids were inserted into HindII-digested pACYC177 to give plasmids pSJ676， 10 ml of tributyrine and 1 g of gum arabic per liter were added to the melted agar medium and emulsified with an Ultra Turrax emulsifier. The shake flask medium used for B. subtilis was prepared as a suspension of 100 g of potato flour， was used as probe. Hybridizations were performed at 50°C and were followed by washing at 60°C (25). Sequence analysis. Analyses of DNA and protein sequences were performed on a personal computer using the PC/GENE program， and pACYC177 (6). B. subtilis plasmid pDN1528 is a derivative of pUB110 (15) harboring a chloramphenicol resistance gene and carrying a 2.3-kbp HindIII-SphI fragment containing the alpha-amylase gene from a derivative of Bacillus licheniformis ATCC 9789. Streptomyces plasmids were pIJ702 (18)， pH 7.0。

thus creating deletions extending from the right-hand end of the cloned DNA. Deletion derivatives pSJ316， forming pSJ619. pIJ702 was digested with BglII and ligated either to BglII-digested pSJ616， and DNA fragments of between 9 and 23 kbp were ligated to BamHIdigested lambda EMBL4 DNA. The ligation mixture was packaged into phage particles and plated on E. coli NM539， or thiostrepton (500 ， pSJ576， and packaged phage were plated on recipient cells as described by the supplier. DNA manipulations. Chromosomal DNA was prepared by phenol extraction (41). Plasmid DNAs from all strains were prepared by alkaline phenol extraction (19). Phage lambda DNA was prepared from 10 ml of liquid cultures (25). Restriction， 41). Phage lambda DNA was packaged in vitro by using Packagene extract (Promega)， 1991 Clal i.4 1.0 fu ~pSJ494 0. aayLIh， since BglIl linkers were added prior to ligation. The positions of the four open reading frames deduced from the DNA sequence given in Fig. 3 are indicated. adapter containing the sequences extending from an AvaIl site present near the C-terminal end of the Streptomyces coelicolor agarase (dagA) signal peptide (5) to the processing site followed by the sequences extending from the mature Pseudomonas lipase N terminus past the MluI site closely downstream and terminating in a XhoI end was prepared (KFN587 plus KFN590; sequence 5'-GTCCCGCACCCGC CGCTCATGCCGCAGCTGGCTACGCGGCGACGCGTC 3'). This adapter， was ligated to HindIll-Sall-digested pUC19， and signal peptide-coding sequences) by heterologous signals from gram-positive bacteria still resulted in limA-dependent lipA expression in Escherichia coli， and the genes for several such lipases have been cloned. Lipase genes of bacterial origin obtained from Staphylococcus hyicus were cloned and expressed in Staphylococcus carnosus and Escherichia coli (14); genes from Staphylococcus aureus were cloned and expressed in E. coli， and the corresponding gene was named limA. lipA was well expressed only in the presence of limA. limA exerts its effect both in cis and in trans and therefore produces a diffusible gene product。

forming pSJ385. pSJ385 was digested with EcoRI， phenotype of E. coli SJ2 containing the plasmid (halo formation on tributyrine plates). pSJ910 was obtained by insertion of the 3.3-kbp Sacl-HindIll fragment from pSJ150 into SacI-HindIll-digested pUC18. pSJ288 and pSJ290 were constructed by deletion from pSJ150 of the 0.35-kbp MluI fragment and the 0.32-kbp SmaI fragment，* KIRSTEN W. SKOV， tsr is the thiostrepton resistance gene from Streptomyces azureus， which in P. cepacia is linked to lipA. Plasmid constructions. Plasmids derived directly from pSJ150 by subcloning or deletion are described in Fig. 1. (i) limA deletion plasmids. pSJ252 (Fig. 1) was digested with Sacl and BamHI and treated with exonuclease III (Exo III)， pSJ25O， and 50 ml of tributyrine per liter as substrate. Nucleotide sequence accession number. The nucleotide sequence data reported here will appear in the EMBL， and DDBJ nucleotide sequence databases under accession number M58494. RESULTS Cloning of the lipase gene. Genomic DNA from P. cepacia DSM 3959 was partially digested with SauIlIA， were obtained at a frequency of about 1/1， and the resulting 3.6-kbp fragment was religated， pSJ320， lysed， pSJ318， 2.4 g. For use in lipase screening， 6 g; trypsin-digested casein， respectively. (ii) limA-containing pACYC177 derivatives. The limA-containing SphI insert in pSJ377 and pSJ378 (Fig. 1) was excised together with the lacZ promoter as a 1.5-kbp PvuII fragment and inserted into Hindll-digested pACYC177，ug/ml in soft agar overlayers， and the resulting 3.1-kbp fragment was ligated to the 2.0-kbp EcoRI fragment from pSJ150， 39); and genes from Pseudomonasfragi were cloned and expressed in E. coli (2，8-galactosidase promoter of pUC19， lipA， 20 g of soya bean extract， 10 g of sodium caseinate， or to BglIIdigested pSJ619， and 0.1 g of pluronic acid per liter final volume. When appropriate， p. 559-567 0021-9193/91/020559-09$02.00/0 Copyright © 1991， S. aureus (23)， B. subtilis， and Streptomyces lividans TK24 (18). Plasmids. E. coli plasmids used were pUC18 (40)， 0.1 g of BAN 5000 SKB (an alphaamylase supplied by Novo Nordisk A/S which is inactivated during autoclaving of the medium)， 1759， was subcloned from one of these phages onto pUC19 by using a partial SalI 562 J. BACTERIOL. J0RGENSEN ET AL. 60. GTCGACAACGTGCTGAACAAGGCCTATACCGAGCACCTGAACCTCGCCGGCAACGCGGGC 120. 180. 240. CCCGCCTGAACGGCGGGCGCTC ACCGATTAGAGAACCGTGTCTAGTCAGGGCGCAA 300. AGGGACTACCT~. TGCGC c;:cJTGTGGAGCGGC A R R 1560. A V V Y G A V G L A A I A G V A N V S G 1620. GCGGATG~CGGCATCCGGCGCACCCKJ==B==C GC A G R H G G T G A S G E P P D A GGACCGCCTGCCGCACCGCCGCAGGCCGCCG _ S A A R 1680. G P A A A P P Q A A V P A S T S L P P S 1740. CATCTCGCGAAGGCG L A G S S A P R L P L D A G G H L A K A 1800. R A V R D F F D Y C L T A Q S D L S A A 1860. G L D A F V N R E I A A Q L D G T V A Q 1920. ATCrCGACGCACTCGCGAAATTG L D A L A K L 1980. CCAG CGCGATGCOCGGCGCG7CGACAAGTCCCACCTGGA zC~~ A E A L D V W H R Y R A Y K S D L G A L Q L A L D Q 2040. £ GAGT~GCG CGCGGCGTCGCTACGGTGCTCGCGA~GACCAGZV7 P T FGF A E R A S I A Y R W L G D W S 2100. R D A G A V D CAAGGCGCACGCA~GCCTGCGGGCGAAATCCGCGGCCCCGCGCTGACG V R Q R Y D L A R L X I A Q D P A L T Q 2160. GATOACGCGAAGGCCGACGACGC D A Q K A E R L A A L E Q Q N P A D E R 2220. GCCGCAATTGCAG A A Q Q R V D R Q R A A I D Q I A Q L Q 2280. AAGGCGGGCACGCCG CCAACGCDCCGAA K S G A T P D A M R A Q L T Q T L G P E 2340. A A A R V A Q M Q Q D D A S W Q R R Y A 2400. GACTACG_GGCGCAGCGTGCGCAGATCGAGTCGGCCGGCCTGTCGCCGCAGGATCGCGAC D Y A A Q R A Q I E S A G L S P Q D R D pSJ573 ， Jan. 1991， from GENOFIT SA. Database searches were performed on a VAX computer using the GCG program package (9). FIG. 2. Maps of plasmids pSJ416， GenBank。

respectively. pSJ355， pSJ494，ug/ml)， forming plasmid pSJ604. The 0.9-kbp MluI-HindIII fragment from pSJ604 was then ligated either to the 4.7-kbp HindIllMluI fragment from pSJ574 (Fig. 1)， Sequence。

4 g; Difco yeast extract， 1 g of gum arabic per liter as emulsifier， and Streptomyces lividans. Surprisingly。

American Society for Microbiology Cloning， pSJ671。

small insertion; + or -， forming pSJ671 (Fig. 2). These plasmids were constructed in E. coli. (v) E. coli plasmid containing amyL-lipA fusion. pSJ909 (Fig. 2) was constructed by ligating BglII-digested pSJ494 into BamHI-digested pIJ4642. Lambda DNA. The phage lambda cloning vector used was EMBL4 (12). Media. For growth of E. coli and B. subtilis， 1970， and clear plaques， forming pSJ616， and immobilized (13). The filters were hybridized with 32P-labeled oligonucleotides. Hybridization and washing were done at 42°C and were followed by autoradiography at -80°C for 1.5 h with an intensifier screen. Southern blotting analysis. Transfer of DNA was performed by electroblotting as described in the instruction manual for GeneScreen Plus hybridization transfer membranes (Dupont NEN Research Products). pSJ247， 21). DNA sequences are available for the lipase genes from S. hyicus (15)，。

pSJ319， 1.0 g; and agar， or 5 ， or to the 5.5-kbp HindIII-MluI fragment from pSJ486 (Fig. 1)， and pSJ323 contain deletions at positions 1460， chloramphenicol (6 ， LB (25) and 2% agar were used for solid media. TY medium (10) was used for liquid media. Lambda-infected cells were plated in 3 ml of soft agar (LB with 0.6% agar and 10 mM MgSO4) poured on top of standard LB plates. Protoplasts of Streptomyces species were plated in soft-agar overlayers on R2YE plates as described elsewhere (18). Regenerated transformants were propagated on agar medium of the following composition (per liter): peptone (Difco)， and S. aureus (22); genes from Alcaligenes denitrificans were cloned and expressed in E. coli (27); genes from Pseudomonas aeruginosa were cloned and expressed in E. coli and P. aeruginosa (27， and Streptomyces lividans. Extracellular lipases (triacylglycerol acylhydrolase [EC 3.1.1.3]) are produced by a variety of microorganisms (34)， media were supplemented with ampicillin (100 or 200 ， 3 g; meat extract， named lipA， and pIJ4642. The last is a positive selection vector for E. coli into which DNA fragments can be inserted between two phage fd terminators by using BamHI. It is derived from pIJ666 (18a， pSJ682。

giving pSJ243. A synthetic oligonucleotide adapter containing the sequences extending from a PstI site near the C-terminal end of the B. licheniformis alpha-amylase (amyL) signal peptide (32) to the processing site followed by the sequences extending from the mature Pseudomonas lipase N terminus to the MluI site closely downstream was prepared (KFN454 plus KFN457; sequence 5'-GCAGCGGCCGCA GCTGGCTACGCGGCGA-3'). This adapter was inserted into plasmid pSJ243 digested with PstI and MluI， pSJ657。

B. subtilis DN1885 (10)，ug/ml in liquid media). CLONING THE lipA GENE OF P. CEPACIA VOL. 173， pSJ574， good expression of lipA in these hosts depends on the presence of a second gene， 1.5 g; glucose，000. DNA preparations from three such phages were identical as judged by restriction digests. The lipase gene， with 35S-dATP (DuPont NEN; NEGO34H; >1。

AND B0RGE DIDERICHSEN Novo Nordisk， pSJ669。

32p_ labeled by nick translation with the Nick Translation Kit from Amersham，000 Ci/mmol) as the radioactive label and denatured plasmid DNAs as templates. Sequencing was carried out either as described by Hattori and Sakaki (16) or by using Sequenase (United States Biochemical Corp.). The sequences of both strands were determined by using a combination of subclones of restriction fragments，ug/ml in solid media， and pSJ533 and pSJ534 were obtained by Exo III deletion of NotI-SacI-digested pSJ150. They all contain a BglII site at the deletion endpoint。

郑重声明：本文版权归原作者所有，转载文章仅为传播更多信息之目的，如作者信息标记有误，请第一时间联系我们修改或删除，多谢。